Войти Отмена
Регистрация       Забыли пароль?

Коронавирус COVID-19 (SARS-CoV-2): обнаружение, характеризация и производство вакцин

Коронавирус COVID-19 (SARS-CoV-2): обнаружение, характеризация и производство вакцин

 


Коронавирус COVID-19 (SARS-CoV-2): обнаружение, характеризация и производство вакцин
 
Мы можем ускорить Ваши работы по исследованию COVID-19 и разработке вакцин
Наша компания является международным поставщиком товаров и услуг в области Life Science и всегда готова помочь Вам в борьбе с COVID-19. Мы объединили все необходимые товары и услуги на одной странице: от первичных материалов и продуктов для обнаружения и характеризации вируса до услуг по производству.
Сложная эпидемиологическая ситуация, вызванная распространением COVID-19, продолжает ухудшаться. В это непростое время мы прилагаем все свои усилия, чтобы обеспечить исследователей, разработчиков и производителей всеми возможными продуктами и услугами, которые требуются для борьбы с COVID-19. Поэтому нашими главными задачами остаются обеспечение безопасности и здоровья наших сотрудников, удовлетворение запросов наших заказчиков, предоставление точной и своевременной информации и поддержание бесперебойного функционирования компании.
Мы организовали международную рабочую группу, непрерывно отслеживающую цепочку поставок как для нашей продукции, так и для ключевых видов сырья, чтобы оперативно урегулировать любые возможные нарушения поставок. При планировании бизнес-процессов мы по-прежнему прикладываем все силы, чтобы обеспечить наших заказчиков на всех направлениях рынка и исследовательские группы по всему миру продуктами и услугами, необходимыми для обнаружения COVID-19 и разработки лекарственных средств.
У Вас есть вопросы по нашей продукции, предназначенной для борьбы с SARS-CoV-2 и COVID-19? Наши технические эксперты незамедлительно окажут Вам поддержку.
Позвоните по номеру: +44 (0)8 00 27 25 72 с 8:30 до 17:30 по центрально-европейскому времени или свяжитесь с нами по e-mail 
COVID_19@merckgroup.com.
Для получения консультации на Вашем языке найдите контактные данные 
здесь.
Мы будем непрерывно пополнять данный раздел новыми продуктами и доступной информацией.
 
Обнаружение вирусов
Характеризация вирусов
Производство вакцин
Производство лекарственных средств
Лабораторное и защитное оборудование


 
Обнаружение вирусов
Мы прилагаем все возможные усилия для обеспечения своевременного снабжения исследователей всеми необходимыми реагентами и экспертной поддержкой в условиях эпидемии SARS-CoV-2. 
Предлагаем Вам ознакомиться с предлагаемым ассортиментом продуктов для очистки вирусной РНК, проведения ОТ-ПЦР, количественной ОТ-ПЦР, иммунологического анализа, а также вспомогательных реагентов, которые помогут Вам в разработке аналитических методик для диагностики SARS-CoV-2.
 Наборы и реагенты для количественного ПЦР-определения коронавируса 2019-nCoV
Наши наборы для количественного ПЦР-определения коронавируса 2019-nCoV (SARS-CoV-2), представленные ниже в продуктовой линейке KiCqStart®доступны для заказа уже сейчас.
  • Для обнаружения с помощью SYBR® Green выберите Праймеры KiCqStart
  • Для обнаружения с помощью зондов выберите Анализы KiCqStart с использованием зондов
Ниже приведён перечень доступных целевых структур для обнаружения:
 
Детектирующая структура
Прямая последовательность
Обратная последовательность
Зонд
SYBR Green 1
GCCTCTTCTCGTTCCTCATCAC
AGCAGCATCACCGCCATTG
 
SYBR Green 2
AGCCTCTTCTCGTTCCTCATCAC
CCGCCATTGCCAGCCATTC
 
Двояко-меченый зонд 1
 CCGCAAGGTTCTTCTTCGTAAG
TGCTATGTTTAGTGTTCCAGTTTTC
AAGGATCAGTGCCAAGCTCGTCGCC
Двояко-меченый зонд 2
GGCTTACCGCAAGGTTCTTC
TGCTATGTTTAGTGTTCCAGTTTTC
AAGGATCAGTGCCAAGCTCGTCGCC
Двояко-меченый зонд 3
CAGGTATATGCGCTAGTTATCAGAC
CCAAGTGACATAGTGTAGGCAATG
AGACTAATTCTCCTCGGCGGGCACG
Двояко-меченый зонд 4
GCAGGTATATGCGCTAGTTATCAG
ACACTGGTAGAATTTCTGTGGTAAC
AGACTAATTCTCCTCGGCGGGCACG

Ниже приведена структура для положительного контроля при обнаружении SARS (на данный момент методика прошла валидацию in silico):
 
Детектирующая структура
Прямая последовательность
Обратная последовательность
Зонд
Двояко-меченый зонд
GCTGTGTGTTTGCCTATGTTGG
ACGTTCACGACTCAGTATCTCAAG
AGCGTGCCTACTGGGTTCCTCGTGC

Ознакомьтесь с актуальной информацией 
об обнаружении SARS-CoV-2019 , касающейся разработки методик анализа и реакционной способности олигомеров, дизайна праймеров и зондов, а также генетического анализа.
Для получения дополнительной информации свяжитесь с нашими специалистами: oligotechserv@merckgroup.com.
 
ОТ-ПЦР и количественная ОТ-ПЦР: молекулярный анализ и вспомогательные реагенты 
Наша компания предлагает широкий ассортимент реагентов, наборов и инструментов для проведения ПЦР, способных удовлетворить Ваши потребности на любой стадии разработки методик определения SARS-CoV-2. Мы предлагаем продукцию стандартной и расширенной функциональности, чтобы Вы могли добиться требуемого уровня достоверности, производительности и точности анализа с использованием ПЦР.
  • Набор Transcriptor One-Step RT-PCR для проведения
  • ОТ-ПЦР
    Набор Transcriptor One-Step RT-PCR разработан с применением инновационной 
  • технологии одностадийной полимеразной цепной реакции с
  • обратной транскрипцией (ОТ-ПЦР). Смесь ферментов, входящая
  • в комплект, содержит Taq ДНК-полимеразу и корректирующую
  • полимеразу, обеспечивающие высокую чувствительность
  • и надёжность результатов обратной транскрипции. Набор
  • Transcriptor One-Step RT-PCR содержит все необходимые
  • компоненты (за исключением матриц и праймеров) для
  • проведения одностадийной ОТ-ПЦР.

  • KAPA PROBE FAST One-Step
    Набор 
    KAPA PROBE FAST One-Step разработан для быстрого высокоэффективного одностадийного количественного определения РНК. Набор KAPA PROBE FAST One-Step пригоден для использования в сочетании с любыми флуорогенными
  • зондами, включая гибридизационные зонды (например, FRET), гидролизуемые зонды (например, TaqMan®) и зонды-молекулярные маяки.
  • Система Titan™ One Tube RT-PCR
    При проведении ПЦР в системе Titan™ One Tube RT-PCR синтез первой цепочки кДНК осуществляется с помощью обратной транскриптазы вируса миелобластоза птиц (AMV),
  • а последующая амплификация кДНК - с помощью смеси ферментов Expand™ High Fidelity, в состав которой входят ДНК-полимераза Taq и корректирующая полимераза.

  • Комплект Quantitative RT-PCR ReadyMix™ для проведения количественной ОТ-ПЦР
    Помимо обратной транскриптазы вируса мышиного лейкоза Молони (M-MLV RT), которая участвует в синтезе первой цепочки кДНК, набор ReadyMix™ для количественной ОТ-ПЦР содержит также растворы ДНК-полимеразы JumpStart Taq DNA, дезоксинуклеотиды 99% чистоты, а также буферные растворы и стабилизаторы, поставляемые в виде растворов двойной концентрации.

  • Комплект KiCqStart® One-Step Probe RT-qPCR ReadyMix™ для проведения одностадийной количественной ОТ-ПЦР с использованием зондов
    Набор KiCqStart® One-Step Probe RT-qPCR ReadyMix™ подходит для работы со всеми типами двояко-меченых зондов и содержит все необходимые реагенты (за исключением матриц РНК и зондов) для проведения количественной ОТ-ПЦР. Возможна поставка комплекта KiCqStart® One-Step Probe RTqPCR ReadyMix™ с референсным красителем ROX™ или без него.
  • Комплект SYBR® Green Quantitative RT-qPCR для количественной ОТ-ПЦР
    Данный набор, сочетающий в себе преимущества обратной транскриптазы вируса мышиного лейкоза Молони (M-MLV RT) и ДНК-полимеразы JumpStart Taq DNA, входящих в состав удобной в работе смеси ReadyMix, позволяет проводить высокочувствительный количественный анализ экспрессии генов.
  •  
    Описание
    № в каталоге
    Transcriptor One-Step RT-PCR Kit
    TOSRTRO
    KAPA PROBE FAST One-Step
    KK4752
    Titan™ One Tube RT-PCR System
    11855476001
    Quantitative RT-PCR ReadyMix™
    QR0200
    KiCqStart® One-Step Probe RT-qPCR ReadyMix™
    KCQS07
    KiCqStart® One-Step Probe RT-qPCR ReadyMix™, Low ROX™
    KCQS08
    KiCqStart® One-Step Probe RT-qPCR ReadyMix™, ROX™
    KCQS09
    Nuclease-Free Water, Molecular Grade
    W4502
    SYBR® Green Quantitative RT-qPCR
    QR0100
    NucleoClean™ Decontamination Spray (alternative to bleach)
    3097S
    ViralXress DNA/RNA Extraction Reagent
    3095
    Nuclease Free Water
    3098
    Продукты предназначены только для исследовательских целей. Не использовать для диагностики.
     
     Сверхчистая вода
    Высокая скорость развития и возрастающее разнообразие исследовательских работ, постоянная смена приоритетов, большое число операторов и ограниченность пространства - все эти факторы стимулируют лаборатории к приобретению универсального, инновационного и удобного в размещении оборудования. Наша система получения сверхчистой воды Milli-Q® IQ 7000 с различными финишными фильтрами соответствует всем перечисленным требованиям.
     
    Основные продукты для разработки методик молекулярной диагностики и иммунологического анализа
    Антитела для разработки методик серологического анализа
    Наша линейка антител подходит для классификации человеческих иммуноглобулинов (IgG, IgM, IgA), в цельной крови для разработки методик серлогического анализа..

     
    Описание
    № в каталоге
    Goat Anti-Human IgG Antibody, HRP conjugate
    AP112P
    Goat Anti-Human IgG Antibody, HRP conjugate
    AP309P
    Anti-human IgM (μ-chain-specific) HRP
    A6907
    Anti-human IgA (α-chain-specific) HRP
    A0295
    Продукты предназначены только для исследовательских целей.  Не использовать для диагностики.
     
    Пробумин
    Бычий сывороточный альбумин диагностического класса, применяемый в протеазочувствительном иммунологическом анализе и в качестве стабилизирующего агента для реагентов белковой природы, требующих низкого содержания IgG, также применяемый в молекулярной биологии. Чистота продукта превышает 98% и обычно равна 100%.

     
    Описание
    Количество в упаковке
    № в каталоге
    Probumin® Bovine Serum Albumin
    1 кг
    820452
    Probumin® Bovine Serum Albumin
    5 кг
    820456
    Probumin® Bovine Serum Albumin
    100 г
    820451
    Продукт предназначен для производственных и исследовательских целей. Продукт не предназначен для употребления в пищу человеком или животными. Не использовать для диагностики.
     
    ProClin™ 300
    Биоцид, разработанный для применения на предприятиях, занимающихся производством диагностических продуктов. Данный препарат является эффективной и безопасной для окружающей среды альтернативой для существующих консервантов, применяемых в реагентах для диагностики. При введении в рекомендованных количествах, препарат ProClin™ не представляет угрозы здоровью, не токсичен и не требует специальных мер по утилизации.
     
    Описание
    № в каталоге
    ProClin™ 300
    48912-U
     
    Стремясь обеспечить все заинтересованные стороны актуальной информацией о своей продукции, компания Merck создала данный веб-сайт, на котором объединила всю доступную информацию о продуктах, которые могут быть актуальны в условиях пандемии COVID-19. Если у Вас имеются вопросы, касающиеся вируса, посетите  веб-сайт Всемирной Организации Здравоохранения, посвящённый COVID-19.
    Вернуться к началу


     
    Характеризация вирусов
    Разработка эффективных вакцин и лекарственных средств начинается с надёжной характеризации вируса. Здесь мы собрали сведения о реагентах и лабораторном оборудовании, предназначенных для исследования механизма прикрепления и проникновения вируса в клетку, вирусной геномики и протеомики, иммунного ответа. Представленные продукты обеспечивают безопасность и эффективность работы с вирусами и другими возбудителями.
     
     Механизмы прикрепления и проникновения вируса в клетку
    Недавние исследования механизма попадания вируса в клетку показали, что SARS-CoV-2 использует рецепторы ангиотензин-превращающего фермента II (ACE2)  для попадания в клетку и  сериновую протеазу TMPRSS2 для примирования S-белка. Используйте нашу продукцию для исследования моноклональных и поликлональных антител и низкомолекулярных веществ, специфичных для соответствующих вирусов, а также для исследования рецепторов, используемых вирусами для прикрепления и проникновения в клетки (включая ACE2).
    Клеточные культуры для размножения вируса
    Ассортимент клеточных культур, применяемых в исследовании механизма прикрепления вируса SARS CoV, его попадания в клетку и размножения, включает в себя клетки Vero, Huh-7D 12 и Caco-2. Все вариант доступны для заказа ниже.
    Для получения информации об использовании клеточных культур для размножения вируса прочитайте нашу статью «Использование клеточных культур для культивирования вирусов и производства вакцин».
     
    Описание
    № в каталоге
    Vero C1008 African green monkey kidney Cell LIne, Clone E6
    85020206-1VL
    Vero C1008 cell line [clone E6, Vero E6]
    85020206
    VeroCCL81 cell line
    84113001
    VeroCCL81 cell line (animal-component free)
    08011101
    16HBE14o- Human Bronchial Epithelial Cell Line
    SCC150
    CACO-2 Human Cell Line
    86010202
    CACO-2 Cell Line human (intestinal permeability characteristics tested)
    09042001
    Huh-7D12 Cell Line human (expresses ACE2 receptor)
    01042712
    293T cell line human
    12022001
    Human Small Airway Epithelial Cells (HSAEpC) Primary human cells (optimized media also available)
    C-12642
    Huh-7D 12 cell line, human
    01042712-1VL
    ACE2 Inhibitor, MLN-4760
    5306160001
    Angiotensin Converting Enzyme-2, ACE2
    SAE0064
    Anti SARS Antibody S-Specific Clone 154C
    MAB8783
    Anti-ACE2 antibody produced in rabbit, Prestige Antibodies® (Enhanced Validation)
    Immunogen:
     ACE2 PrEST
    Applications:
     WB, IHC
    HPA000288
    Anti-ACE2 antibody produced in rabbit
    Immunogen:
     Synthetic peptide directed towards the middle region of human ACE2
    Applications:
     IF, IHC, ELISA, WB
    SAB3500346
    Anti-ACE2 antibody produced in rabbit
    Immunogen:
     Synthetic peptide directed towards the middle region of human ACE2
    Applications:
     WB, IHC
    SAB2100025
    Anti-ACE2 antibody produced in rabbit
    Immunogen:
     Synthetic peptide directed towards the N-terminus of human ACE2
    Applications:
     IF, IHC, ELISA, WB
    SAB3500978
    Anti-ACE2 antibody produced in rabbit
    Immunogen:
     Synthetic peptide directed towards the C-terminus of human ACE2
    Applications:
     IF, IHC, ELISA, WB
    SAB3500977
    Anti-ACE2 antibody, clone 4G5.1
    MABN59
    ANTI-BAT1(C-TERMINAL)
    SAB1307254
    Anti-CD209
    SAB1407409
    Anti-SARS Antibody, M Specific
    MAB8787
    Anti-TMPRSS2 antibody produced in rabbit, Prestige Antibodies®
    HPA035787
     
     Анализ с проведением ОТ-ПЦР
    Здесь собраны реагенты и инструменты для исследования генома вируса, включая наборы NAP для очистки вирусной РНК, высокоэффективные системы для ОТ-ПЦР и количественной ОТ-ПЦР, наборы для синтеза кДНК и многое другое. Наборы для одностадийного проведения анализа позволяют упростить и ускорить процедуру амплификации генов в широком динамическом диапазоне.
     
    Описание
    № в каталоге
    One Step RT-PCR Master Mix Kit
    71978
    Transcriptor One-Step RT-PCR Kit
    TOSRTRO
    Transcriptor High Fidelity cDNA Synthesis Kit
    THIFICDNARO
    Titan One Tube RT-PCR System
    11855476001
    KiCqStart® One-Step Probe RT-qPCR ReadyMix™
    KCQS07
    KAPA PROBE FAST One-Step
    KK4752
    M-MLV Reverse Transcriptase
    M1302
    RNAseZAP™
    R2020
    SYBR® Green JumpStart™ Taq ReadyMix™
    S4438
    TRI reagent
    T9424
    QR0100
    Quantitative RT-PCR ReadyMix™
    QR0200
    Milli-Q® IQ 7000 Water System
    ZIQ7000T0
    BioPak® application pak
    CDUFBI001
     
     Инструменты для исследования вирусных белков
    Наши гели и колонки для аффинной хроматографии, а также готовые к использованию буферные растворы для клеточного лизиса позволяют проводить быструю экстракцию вирусных белков для сокращения времени исследования и повышения точности результатов. Узнайте, как использовать метод вестерн-блоттинга для подтверждения результатов очистки вируса.
    Недавно было установлено, что исследования белок-белковых взаимодействий имеют высокую важность для всестороннего изучения Covid-19. Для подтверждения протекания эндогенных белок-белковых взаимодействий можно использовать технологию Duolink™ PLA (метод близкого лигирования) с последующим считыванием результатов методом микроскопии или цитометрии в потоке.
    Узнайте, как использовать метод вестерн-блоттинга для подтверждения результатов очистки вируса.
     
    Описание
    № в каталоге
    HIS-Select® Nickel Affinity Gel
    P6611
    Protein A-Sepharose®
    P3391
    RIPA Buffer
    R0278
     
     Редактирование генов
    Здесь Вы можете найти реагенты для нокаута или нокдауна генов рецептора ACE2 или иных генов, задействованных при поражении SARS-CoV-2 по технологии shRNA или CRISPR в  плазмидном, лентивирусном или синтетическом формате.
    Для получения более подробной информации о редактировании генов перейдите на нашу страницу, посвящённую достижениям геномики.
    shRNA ACE2
    CRISPR ordering
     
    Ознакомьтесь с нашими библиотеками функциональной геномики CRISPR и RNAi для подбора инструментов для скрининга генов, делающих клетку более восприимчивой или устойчивой к инфицированию, репликации и развитию COVID-19, что позволить разрабатывать генетические тесты, которые можно использовать в качестве вторичной диагностики при оценки риска осложнений COVID  а также риск инфицирования
     
     Иммунология
    Иммунный ответ пациентов на коронавирусную инфекцию проявляется по-разному и может стать причиной неблагоприятного клинического исхода. Гипервоспалительный иммунный ответ способен привести к развитию «цитокинового шторма» (CSS), существенно усугубляющего течение болезни. Цитокины и мультиплексные панели Milliplex® для обнаружения цитокинов/хемокинов дают исчерпывающую информацию о воспалительной реакции, развивающейся в тканях человека и приматов.
     
    Описание
    № в каталоге
    MILLIPLEX® MAP Human Cytokine/Chemokine/Growth Factor Panel A - Immunology Multiplex Assay
    HCYTA-60K
    MILLIPLEX® MAP Human Cytokine/Chemokine/Growth Factor Panel A 38 Plex Premixed Magnetic Bead Panel - Immunology Multiplex Assay
    HCYTA-60K-PX38
    MILLIPLEX® MAP Human Cytokine/Chemokine/Growth Factor Panel A 38 Plex Premixed Magnetic Bead Panel – BULK (Space Saver) PACKAGING - Immunology Multiplex Assay
    HCYTA-60K-PXBK38
    MILLIPLEX® MAP Human Cytokine/Chemokine/Growth Factor Panel A 48 Plex Premixed Magnetic Bead Panel - Immunology Multiplex Assay
    HCYTA-60K-PX48
    MILLIPLEX® MAP Human Cytokine/Chemokine/Growth Factor Panel A 48 Plex Premixed Magnetic Bead Panel – BULK (Space Saver) PACKAGING - Immunology Multiplex Assay
    HCYTA-60K-PXBK48
     
    Стремясь обеспечить все заинтересованные стороны актуальной информацией о своей продукции, компания Merck создала данный веб-сайт, на котором объединила всю доступную информацию о продуктах, которые могут быть актуальны в условиях пандемии COVID-19. Если у Вас имеются вопросы, касающиеся вируса, посетите  веб-сайт Всемирной Организации Здравоохранения, посвящённый COVID-19.
     
     
     
    Производство вакцин
    Эффективность процедур обеспечения качества, постоянный технический контроль и точность результатов исследования являются ключевыми факторами при производстве безопасных лекарственных средств. Наши решения для оценки микробиологической нагрузкистерильности и определения микоплазмы, а также проведения мониторинга окружающей среды, помогут Вам добиться соответствия высочайшим стандартам качества и требованиям нормативной документации.
     
     Upstream - культивирование
    Наше портфолио включает биореакторы, среды для культивирования, питательные добавки к средам, критически важные первичные материалы, буферные растворы, миксеры и ряд фильтрационных технологий, предотвращающих микробное загрязнение среды и гарантирующих высокий выход и производительность процесса.
     
    Описание
    № в каталоге
    Стадия процесса
    CellPrime® rTrypsin
    1.06301.0001
    Культивирование клеток: ферменты
    EX-CELL® MDCK Serum-Free Medium for MDCK Cells
    24581C-10L
    Культивирование клеток: культуральные среды
    Mobius® Single-Use 3L Bioreactor
    CR0003L200
    Культивирование клеток: Биореакторы SUB
    Viresolve Barrier Micro Process Development Kit
    VBMSPDKNB9
    Первичная фильтрация вирусовфильтры
    Millipore Express® SHR with prefilter membrane in 25 mm Optiscale® devices
    SHVEA25NB6
    Стерилизующая фильтрация: фильтры
    Millipore Express® SHC membrane in 25 mm Optiscale® devices
    SHGEA25NB6
    Стерилизующая фильтрация: фильтры
     
     Выделение и очистка молекулы
    Мы предлагаем широкий выбор технологий фильтрации, перечень буферных растворов , растворов для CIP очистки , фильтрационного оборудования из нержавеющей стали и емкостей Single-Use с одноразовыми стерильными пластиковыми мешками, а также перечень услуг по валидации процесса любого масштаба. Наша продукция в сочетании с многолетним опытом технических экспертов поможет в решении любой задачи в области приготовления вакцин.
     
    Описание
    № в каталоге
    Стадия процесса
    Millistak+ Pod Depth Filter, CE50 media series, 0.027 m2 surface area, 1/4 in. Hose Barb connection
    MCE50027H1
    Выделение/очистка: фильтры
    Millistak+ Depth Filter in µPod format, CE50 media series, 23 cm2 surface area, Luer fitting connection
    MCE5023CL3
    Выделение/очистка: фильтры
    Optiscale Capsule Polysep II 1.0/0.5 µm 1/4 in. HB/HB
    SGW6A47HH3
    Выделение/очистка: фильтры
    Millistak+ Depth Filter in µPod format, D0HC media series, 23 cm2 surface area, Luer fitting connection
    MD0HC23CL3
    Выделение/очистка: фильтры
    Millistak+ HC Pod Depth Filter, D0HC media series, 0.027 m2 surface area, 1/4 in. Hose Barb connection
    Выделение/очистка: фильтры
    Pellicon XL Filter Module Durapore 0.45 µm 50c m2
    PXHVMPC50
    Выделение/очистка: фильтры
    Polysep™ II 1.0/0.2/0.1 µm
    SGW1A47HH3
    Выделение/очистка: фильтры
    Milligard® 0.2 µm
    SW03A47HH3
    Выделение/очистка: фильтры
    Milligard® PES 1.2/0.2 µm nominal
    SMP2A25NB6
    Выделение/очистка: фильтры
    Triton X-100
    1.08643.1000
    Инактивация вирусов: ПАВ
    Benzonase® suitable for biopharmaceutical production EMPROVE® bio
    1.01697
    Удаление ДНК/РНК: Обработка нуклеазой
    Benzonase® suitable for biopharmaceutical production EMPROVE® bio
    1.01695
    Удаление ДНК/РНК: Обработка нуклеазой
    Benzonase® ELISA kit II for the immunological detection of Benzonase®
    1.01681
    Иммуноанализ: ELISA набор
    Pellicon XL Ultrafiltration Module Biomax 300 kDa 0.005 m2
    PXB300C50
    Ультрафильтрация/диафильтрация
    Pellicon® 2 Mini Ultrafiltration Module Biomax-100 C 0.1 m 2
    P2B100C01
    Ультрафильтрация/диафильтрация
    Pellicon® 2 Mini Ultrafiltration Module Biomax-300 C 0.1 m 2
    P2B300C01
    Ультрафильтрация/диафильтрация
    MiniChrom Column Eshmuno® Q, 5 ml
    1.25074.0001
    Хроматографическая очистка
    NatriFlo HD-Q Recon Mini
    NXF-01
    Хроматографическая очистка
    NatriFlo HD-Q Pilot
    NXF-10
    Хроматографическая очистка
    MiniChrom Column Fractogel DEAE (M), 5 ml
    1.25079.0001
    Хроматографическая очистка
    MiniChrom Column Fractogel TMAE (M), 5 ml
    1.25069.0001
    Хроматографическая очистка
    Durapore®  0.22 µm membrane in 25 mm Optiscale® devices
    SVGLA25NB6
    Финишная стерилизующая фильтрация
    Millipore Express® SHC membrane in 25 mm Optiscale® devices
    SHGEA25NB6
    Финишная стерилизующая фильтрация
     
     Приготовление финишной рецептуры
    Мы предлагаем полный спектр химических реагентов, вспомогательных веществ и липидов, разработанных специально для производств, сопряжённых с высоким риском, таких как производство вакцин. Наши инновационные полимеры и липиды для доставки лекарственных средств, включая сквален и кастомизированные липидные соединения, обладают уникальными характеристиками, позволяющими значительно упростить технологические процессы, связанные с приготовлением препарата. Большинство вспомогательных ингредиентов, выпускаемых нашей компанией, покрывается программой Emprove®, в рамках которой мы поставляем нашим заказчикам полный пакет регистрационных документов для облегчения и ускорения составления досье для регулирующих организаций. Перечень наших вспомогательных веществ для приготовления биомолекулярных препаратов можно найти здесь.
     
     Тестирование биологической безопасности 
    Наш предыдущий опыт с вирусом Зика, атипичной пневмонией и Эболой позволяет нам оперативно выполнять сервису по тестированию биологической безопасности продуктов в условиях пандемии COVID-19. Разработчики и производители вакцин и лекарственных препаратов по всему миру доверяют нашим экспертным знаниям, надёжным и валидированным методикам,опыту взаимодействия с регулирующими организациями, выбирая нас партнерами при ускоренной разработке вакцин.
    Узнайте больше о полном ассортименте Услуг по тестированию биологической безопасности продуктов BioReliance®.
    Узнайте больше о полном ассортименте услуг по характеризации BioReliance®.
     
     Контроль качества и мониторинг производственной среды
    Эффективность процедур обеспечения качества, постоянный технический контроль и точность результатов исследования являются ключевыми факторами при производстве безопасных лекарственных средств. Наши решения для выявления микроорганизмов и определение стерильности помогут Вам добиться соответствия высочайшим стандартам качества и требованиям нормативной документации.
     
    Продукт
    Вид работ
    Milliflex Oasis® Filtration System
    Определение микробиологической чистоты
    Milliflex® Quantum Rapid Detection
    Определение микробиологической чистоты
    Steritest™ NEO
    Испытание на стерильность
    Steritest Media and Rinsing Fluids
    Испытание на стерильность
    Steritest™ Symbio Pumps
    Испытание на стерильность
    PyroMAT™ System
    Определение пирогенности
    Active Air Monitoring- MAS-100® Family/RCS® Series
    Мониторинг производственной среды
    Air Monitoring Media- Contact Plates, HYCON® Agar Strips, M Air T® Cassettes, Settle Plates
    Мониторинг производственной среды
    Passive Air Monitoring- ICR and LI Settle Plates
    Мониторинг производственной среды
    Surface & Personnel Monitoring- Contact Plates, HYCON® Contact Slides, ICR Swabs
    Мониторинг производственной среды
    Settle Plates for Active and Passive Air Monitoring ICR LI
    Мониторинг производственной среды
    Microbial Air Samplers MAS for Isolators in the Pharmaceutical Industry
    Мониторинг производственной среды
    Microbial Air Samplers for Isolators in the Pharmaceutical Industry
    Мониторинг производственной среды
    Contact Plates for Personnel and Surface Monitoring ICR RT
    Мониторинг производственной среды
    Media Fill Testing in the Pharmaceutical Industry
    Контроль асептического розлива
    Milli-Q® IQ 7000 Water System
    Сверхчистая вода
    BioPak® application pak
    Сверхчистая вода
     
     Услуги по разработке и производству
    Наша компания является экспертом высочайшего уровня в разработке технологических процессов и производстве лекарственных средств на основе вирусов. Наши предприятия и эксперты являются мировыми лидерами в производстве продуктов на основе вирусов: от лабораторных токсикологических исследований и изготовления препаратов для первых стадий испытаний до коммерческого производства и расфасовки продукции. Узнайте больше о нашем производстве продуктов для вирусной и генной терапии BioReliance® .
    Предлагаемые нашей компанией услуги по клеточной инженерии,подкрепленные обширным опытом в производстве кастомизированных клеточных линий для совершенствования процесса производства вакцин, помогут Вам добиться повышения титра выпускаемых вакцин и облегчат масштабирование процесса культивирования клеток. Мы готовы работать с любой исходной клеточной линией по Вашему выбору и создать нужную Вам модификацию.
    Стремясь обеспечить все заинтересованные стороны актуальной информацией о своей продукции, компания Merck создала данный веб-сайт, на котором объединила всю доступную информацию о продуктах, которые могут быть актуальны в условиях пандемии COVID-19. Если у Вас имеются вопросы, касающиеся вируса, посетите  веб-сайт Всемирной Организации Здравоохранения, посвящённый COVID-19.



     
    Производство лекарственных средств
    Эффективность процедур обеспечения качества, постоянный технический контроль и точность результатов исследования являются ключевыми факторами при производстве безопасных лекарственных средств. Наши решения для оценки микробиологической нагрузкистерильности и определения микоплазмы, а также проведения мониторинга окружающей среды, помогут Вам добиться соответствия высочайшим стандартам качества и требованиям нормативной документации.
     
     Лекарственные средства на основе молекул химического синтеза
    Разработка и производство классических лекарственных средств
    Приоритетными задачами для производителей противовирусных или иных низкомолекулярных лекарственных средств всегда являются подбор устойчивого состава препарата, соответствие требованиям нормативной документации и стандартам качества.
    Мы обладаем значительным опытом в данной отрасли промышленности и понимаем, какие задачи возникают перед Вами в ходе разработки и производства низкомолекулярных лекарственных средств и препаратов, поэтому наши продукты и услуги ориентированы на оказание Вам всесторонней поддержки. Кликните по этой ссылке, чтобы узнать больше о предлагаемом ассортименте и ознакомиться с технической документацией по теме.
    Полные комплексные решения для оценки генотоксичности
    В линейке BioReliance® представлены услуги по оценке генотоксичности продуктов, позволяющие выявить токсические, мутагенные, кластогенные и трансформирующие эффекты препаратов с помощью хорошо изученных тест-систем. Наши научные сотрудники и современные производственные мощности предоставляют самые полные и современные системы для оценки генотоксичности.
     Анализ потенциальных лекарственных средств с антивирусным или иным действием
    В перечень предлагаемых нашей компанией аналитических решений входят стандартные и эталонные материалыколонки для ВЭЖХ и УВЭЖХ и растворители для проведения анализа при разработке и техническом контроле лекарственных средств.
    В настоящее время специалисты занимаются исследованием эффективности различных препаратов1 при лечении инфекции COVID-19. В число этих препаратов входят лопинавир, ритонавир2, хлорохин 3 и финголимод4. Мы готовы предложить Вам сертифицированные эталонные материалы и первичные фармакопейные стандарты для исследования указанных веществ.
     
    Перечень сертифицированных эталонных материалов и первичных фармакопейных стандартов
    № в каталоге
    Lopinavir United States Pharmacopeia (USP) Reference Standard
    1370101
    Lopinavir European Pharmacopoeia (EP) Reference Standard
    Y0001498
    Lopinavir Pharmaceutical Secondary Standard; Certified Reference Material
    PHR1927
    Ritonavir United States Pharmacopeia (USP) Reference Standard
    1604803
    Ritonavir European Pharmacopoeia (EP) Reference Standard
    Y0000714
    Ritonavir British Pharmacopoeia (BP) Reference Standard
    BP1210
    Ritonavir Pharmaceutical Secondary Standard; Certified Reference Material
    PHR1734
    Chloroquine phosphate United States Pharmacopeia (USP) Reference Standard
    1118000
    Chloroquine phosphate Pharmaceutical Secondary Standard; Certified Reference Material
    PHR1258
    Fingolimod Hydrochloride United States Pharmacopeia (USP) Reference Standard
    1270480
    Fingolimod hydrochloride European Pharmacopoeia (EP) Reference Standard
    Y0002055
     
     Лекарственные препараты, получаемые из плазмы
    Производители плазмы исследуют возможность применения лекарственных препаратов, получаемых из плазмы, для лечения инфекции COVID-19. Особенности процесса производства плазмы заметно разнятся в зависимости от применяемых технологий. Посетите наш Центр данных о плазме для получения информации о типичных трудностях, связанных с производством лекарственных средств из плазмы, и о предлагаемых нами способах их преодоления.
    Ознакомьтесь с нашей брошюрой для получения общей информации о продуктах и услугах для производителей лекарственных препаратов из плазмы.
    Ниже представлен перечень продуктов для хроматографии и тангенциальной фильтрации, пригодных для работы с плазмой.
     
    Описание
    № в каталоге
    ESHMUNO P anti-A
    1.20094
    ESHMUNO P anti-B
    1.20095
    Fractogel EMD TMAE (M)
    1.16881
    Fractogel EMD TMAE (S)
    1.16887
    Fractogel EMD TMAE Hicap (M)
    1.10316
    Fractogel EMD TMAE Medcap (M)
    1.16885
    Pellicon 3 Cassettes
     
    Viresolve® Pro Solution
    VPMNVALNB9
    Viresolve®  Pro Micro Shield kit
    VPMSKITNB9
    Viresolve®  Pro Micro Shield H kit
    VPMHKITNB9
     
    Моноклональные антитела - Услуги для узкоспециализированных контрактных фармацевтических компаний
    Полные решения BioReliance®
    Ваша компания нашла перспективную молекулу, потенциально пригодную для создания лекарства против COVID-19? Если у Вас недостаточно ресурсов, мы можем разработать и произвести Ваш лекарственный препарат для Вас. При этом мы готовы предложить Вам гибкую модель сотрудничества с оперативной разработкой и полным отсутствием авансовых платежей или сборов за бронирование производственных мощностей. Наши адаптивные решения для узкоспециализированных фармацевтических компаний позволят Вам повысить эффективность управления рисками и неопределённостью проекта и проведут Вас по всем стадиям процесса: от разработки клеточной линии и технологического процесса до производства, отвечающего требованиям надлежащей производственной практики (GMP).
    Ознакомьтесь с нашим исчерпывающим ассортиментом услуг по производству моноклональных антител.
     
     Моноклональные антитела - Продукты и услуги по проведению испытаний
    Мы располагаем полным портфолио химических веществ, систем, расходных материалов, а также предлагаем полный спектр услуг по характеризации и исследованию продукции для облегчения Вашего производства моноклональных антител. У нас Вы найдёте всё необходимое для любых стадий процесса, в любом исполнении (одноразовое или стальное оборудование), для традиционного или интенсивного производства.
    Ознакомьтесь с нашим ассортиментом продукции и услуг для всех стадий Вашего процесса производства моноклональных антител.
     
     Контроль качества и мониторинг производственной среды
    Эффективность процедур обеспечения качества, постоянный технический контроль и точность результатов исследования являются ключевыми факторами при производстве безопасных лекарственных средств. Наши решения для обнаружения микроорганизмов и обеспечения стерильности помогут Вам добиться соответствия высочайшим стандартам качества и требованиям нормативной документации.
     
    Продукт
    Вид работ
    Milliflex Oasis® Filtration System
    Определение микробиологической чистоты
    Milliflex® Quantum Rapid Detection
    Определение микробиологической чистоты
    Steritest™ NEO
    Испытание на стерильность
    Steritest Media and Rinsing Fluids
    Испытание на стерильность
    Steritest™ Symbio Pumps
    Испытание на стерильность
    PyroMAT™ System
    Испытание на стерильность
    Active Air Monitoring- MAS-100® Family
    Мониторинг производственной среды
    Air Monitoring Media- HYCON® Agar Strips, Settle Plates
    Мониторинг производственной среды
    Passive Air Monitoring- ICR and LI Settle Plates
    Мониторинг производственной среды
    Surface & Personnel Monitoring- Contact Plates, HYCON® Contact Slides, ICR Swabs
    Мониторинг производственной среды
    Settle Plates for Active and Passive Air Monitoring ICR LI
    Мониторинг производственной среды
    Microbial Air Samplers MAS for Isolators in the Pharmaceutical Industry
    Мониторинг производственной среды
    Microbial Air Samplers for Isolators in the Pharmaceutical Industry
    Мониторинг производственной среды
    Contact Plates for Personnel and Surface Monitoring ICR RT
    Мониторинг производственной среды
    Media Fill Testing in the Pharmaceutical Industry
    Мониторинг производственной среды
    Milli-Q® IQ 7000 Water System
    Сверхчистая вода
    BioPak® application pak
    Сверхчистая вода
     
    Стремясь обеспечить все заинтересованные стороны актуальной информацией о своей продукции, компания Merck создала данный веб-сайт, на котором объединила всю доступную информацию о продуктах, которые могут быть актуальны в условиях пандемии COVID-19. Если у Вас имеются вопросы, касающиеся вируса, посетите  веб-сайт Всемирной Организации Здравоохранения, посвящённый COVID-19.
     
     

     
    Определение АТФ и санитарная обработка
    Недавние исследования Национального Института Здоровья показали, что вирус может сохранять жизнеспособность в течение 2-3 суток. Система MVP Icon® позволяет осуществлять быструю и простую оценку эффективности процедур очистки и дезинфекции без непосредственного определения количества вирусов наподобие SARS-CoV-2. Система MVP Icon® измеряет количество аденозинтрифосфата (АТФ), являющегося индикатором загрязнения поверхностей частицами объектов окружающей среды. Результаты исследования доступны менее чем через минуту после отбора пробы и могут быть приложены к протоколу исследования для последующей оценки. Система MVP Icon® поможет Вам и Вашим сотрудникам контролировать качество очистки и дезинфекции.
     
    Описание
    № в каталоге
    MVP Icon®
    78300BC
    MVP Surface Sampling Device
    64003-100
     
     Лабораторное оборудование
     
    Описание
    № в каталоге
    PCR strip tubes, thin wall, 8 per strip, 0.2 mL
    AXYPCR0208A
    Corning® Thermowell GOLD PCR 8 well tube strips
    CLS3740
    Corning® microcentrifuge tubes with screw cap, 1.5 mL
    CLS430909
    Eppendorf® Flex-Tubes Microcentrifuge Tubes, 1.5mL
    EP022363514
    Corning® Axygen® PCR Microplate
    AXYPCR96C
    Corning® 96 well protein crystallization plates
    CLS3550
    Pipette filter tips, universal fit, size 100 μL
    AXYTF100
    Corning® DeckWorks™ barrier pipet tips, 0.1 - 10μL
    CLS4135
    EP0030077806
    Corning® CoolRack®, XT-M-PCR, 12 x 1.5 or 2 mL microfuge tubes and 6 strip wells
    CLS432054
    Corning® LSE™ mini microcentrifuges, AC/DC input 110 - 240 V
    CLS6770
    Eppendorf® MiniSpin®, with rotor F-45-12-11, for 1.5-2.0 mL tubes, AC/DC input 120 V
    EP022620100
    Eppendorf Research® plus Pipette, fixed volume, single-channel, volume 10 μL
    EP3124000024
    Eppendorf Research® Plus G, 3-pack, option 2, 2-20 uL/20-200 uL/100-1000 uL, includes epT.I.P.S.® box
    EP3123000918
    Eppendorf Research® Plus G, 12-channel, variable, volume (0.5-10 μL)
    EP3125000028
    Eppendorf® Tube Rack for 1.5 and 2.0 mL Tubes, Holds 36 x 1.5-2 mL tubes
    EP0030119819
    Millicell® Hanging Cell Culture Insert, PET 0.4 μm, 12-well, 48/pk
    MCHT12H48
     
    Стремясь обеспечить все заинтересованные стороны актуальной информацией о своей продукции, компания Merck создала данный веб-сайт, на котором объединила всю доступную информацию о продуктах, которые могут быть актуальны в условиях пандемии COVID-19. Если у Вас имеются вопросы, касающиеся вируса, посетите  веб-сайт Всемирной Организации Здравоохранения, посвящённый COVID-19.
     

     
     

 

Данные для заказа

Оформить


Ваши данные в безопасности и не
будут передаваться третьим лицам

+